Skip to main content
Download PDF
  • Research article
  • Open access
  • Published:

Multiple conserved regulatory domains promote Fezf2 expression in the developing cerebral cortex

Neural Development volume 9, Article number: 6 (2014) Cite this article

Abstract

Background

The genetic programs required for development of the cerebral cortex are under intense investigation. However, non-coding DNA elements that control the expression of developmentally important genes remain poorly defined. Here we investigate the regulation of Fezf2, a transcription factor that is necessary for the generation of deep-layer cortical projection neurons.

Results

Using a combination of chromatin immunoprecipitation followed by high throughput sequencing (ChIP-seq) we mapped the binding of four deep-layer-enriched transcription factors previously shown to be important for cortical development. Building upon this we characterized the activity of three regulatory regions around the Fezf2 locus at multiple stages throughout corticogenesis. We identified a promoter that was sufficient for expression in the cerebral cortex, and enhancers that drove reporter gene expression in distinct forebrain domains, including progenitor cells and cortical projection neurons.

Conclusions

These results provide insight into the regulatory logic controlling Fezf2 expression and further the understanding of how multiple non-coding regulatory domains can collaborate to control gene expression in vivo.

Background

Current estimates suggest that greater than half of evolutionarily conserved sequences in the human genome do not correspond to protein coding regions [1–4]. Transcriptional enhancers, non-coding DNA sequences that promote gene expression in a spatial and temporal manner, constitute a substantial portion of these regions [5]. Genome-wide association studies (GWAS) have identified sequence variations within putative enhancers that are associated with a wide range of neurological disorders such as autism, epilepsy, and schizophrenia [6–10]. However, the function of these DNA elements during normal brain development remains poorly understood [11].

The cerebral cortex contains six layers of projection neurons that are generated in a stereotyped manner such that deep-layer neurons, layers 5 and 6 (L5 and L6), are born before upper-layer neurons [12]. It has previously been shown that the transcription factor Fezf2 is necessary and sufficient for the generation of deep-layer subcerebral projection neurons (SCPNs) [13–16]. Collectively, these studies suggest that Fezf2 functions high in a transcriptional hierarchy that regulates SCPN development and fate specification [14, 17–19]. Despite the essential role of Fezf2 in neural development, little is known about how its transcription is precisely regulated.

To investigate the regulatory mechanisms controlling Fezf2 transcription, we utilized chromatin immunoprecipitation combined with high throughput DNA sequencing (ChIP-seq) to identify a transcription factor-binding signature around the Fezf2 locus. Guided by our ChIP-seq data, we mapped a promoter that was sufficient for reporter gene expression in the cerebral cortex throughout cortical development, and investigated the activity of two putative Fezf2 enhancers. We demonstrate that a downstream enhancer, 434, is sufficient to drive expression in cortical progenitor cells while a putative upstream enhancer, 1316, is strictly active in deep-layer neurons within the cortex. Taken together, these results provide insight into the developmental programs that promote Fezf2 expression during development of the cerebral cortex.

Results

Fezf2 is dynamically expressed during development of the cerebral cortex

Towards understanding how Fezf2 transcription is regulated, we first examined its expression during cortical neurogenesis (Figure 1A-C’). Consistent with previous reports [20, 21], at E12.5 Fezf2 expression was detected in ventricular zone (VZ) progenitors and deep-layer cortical neurons (Figure 1A-A’). At E15.5 Fezf2 expression began to decline in L6, but remained high in L5 (Figure 1B-B’). Expression at P0 was similar to E15.5 (Figure 1C-C’). Thus, at late stages of cortical development, expression of Fezf2 in the cerebral cortex was restricted to three distinct domains: higher expression in L5 neurons, and lower expression in L6 neurons and progenitors (Figure 1C-C’). This dynamic spatial and temporal expression pattern suggests that Fezf2 transcription is under the control of a complex regulatory program.

Figure 1
figure 1

F ezf2 is dynamically expressed during cortical development. In situ hybridization at E12.5 (A-A’), E15.5 (B-B’), and P0 (C-C’) for Fezf2 reveals its expression pattern during development. Ctx, cortex; LGE, lateral ganglionic eminence; LV, lateral ventricle; MGE, medial ganglionic eminence; PP, preplate; Str, striatum; VZ, ventricular zone. Scale bars: (A) 100 μm, (A’) 10 μm, (B) 250 μm, (B’) 25 μm, (C) 500 μm, (C’) 50 μm.

Full size image

Identification of putative regulatory regions around the Fezf2 locus

Recent work has identified several transcription factors that are essential for cortical neuron fate specification and differentiation. Among these, SOX5 and TBR1 appear to directly regulate Fezf2 transcription [22–24]. Using chromatin isolated from E15.5 mouse cortices, we mapped the binding of transcription factors expressed in L5 and L6 that were previously shown to be important for cortical development. These included FOXG1, NFIB, SOX5, and TBR1 [22–33]. We found that FOXG1, SOX5, and TBR1 bound to the evolutionarily conserved region immediately upstream of Fezf2 (Figure 2B), suggesting that this region may contain the Fezf2 promoter. Interestingly, all of these factors bound to a previously identified enhancer downstream of Fezf2, enhancer 434 (also known as E4) (Figure 2B). In addition to the upstream region and enhancer 434, FOXG1 and TBR1 bound a region in the neighboring Cadps gene, near the 5’ end of Fezf2 (Figure 2C). Taken together, our ChIP-seq results indicate that multiple transcription factors that are expressed in deep-layer neurons and are critical for cortical development bind at or near the Fezf2 locus.

Figure 2
figure 2

Mapping of transcription factor binding around the Fezf2 locus. (A) Diagram of the Fezf2 locus indicating positions of the 2.7 kb promoter and the putative enhancers 434, and 1316. (B, C) ChIP-seq was used to map the binding of transcription factors around the Fezf2 locus. (B) An overview of binding around enhancer 434 and the upstream conserved region. (C) An overview of factor binding around enhancer 1316. (B, C) Peaks called by MACS are highlighted in grey.

Full size image

To determine the significance of our ChIP-seq data we searched the VISTA Enhancer Browser (http://enhancer.lbl.gov) for sequences in and near Fezf2 that may regulate its expression [34]. This approach uncovered several enhancers around Fezf2. These included an enhancer at the 5’ side of Fezf2, enhancer 1316, and the previously studied enhancer at the 3’ side, enhancer 434 (Figure 2A). Our ChIP-seq data demonstrated binding within or near these enhancers, suggesting they are likely important for regulating Fezf2 transcription within the cerebral cortex (Figure 2B,C).

The 2.7 kb promoter is active across all Fezf2 expression domains

Previous work identified the 2.7 kb region upstream of and including the Fezf2 start codon as sufficient to drive forebrain expression before the onset of cortical neurogenesis [35]. This region was bound by multiple transcription factors in our ChIP-seq dataset (Figure 2B). We generated stable transgenic lines expressing the LacZ reporter under the control of this 2.7 kb sequence to study its activity throughout cortical development. When the earliest-born cortical projection neurons were being generated at E11.5, we observed LacZ activity throughout the cortex that mimicked endogenous Fezf2 expression (compare Figure 3A with Figure 1A). We observed ß-gal expression in SOX2+ cortical progenitor cells and in TBR1+ and Tuj1+ postmitotic neurons (Figure 3B-D).

Figure 3
figure 3

Promoter activity of the 2.7 kb fragment during cortical development. (A) X-Gal staining at E11.5 revealed reporter activity in the cerebral cortex, similar to endogenous Fezf2 expression. (B-D) Immunohistochemistry with ß-Gal antibody combined with SOX2 (B), Tuj1 (C), and TBR1 (D) antibodies. (E) Whole mount X-Gal staining of P0 brains demonstrating expression in the forebrain. (F) X-Gal staining of P0 brain sections. (G-I’) Immunohistochemistry using ß-Gal antibody combined with antibodies for SOX2 (G, G’), CTIP2 (H, H’) and SATB2 (I, I’). Arrows represent co-expression of LacZ and the indicated markers. Arrowheads indicate a lack of co-expression. PP, preplate. Scale bars: (A) 200 μm, (D) 50 μm, (E) 250 mm, (F) 500 μm, (I) 100 μm, (I’) 50 μm.

Full size image

We next examined 2.7 kb promoter activity at P0. Whole mount X-Gal staining revealed expression throughout the cerebral cortex in a high anterior-medial to low posterior-lateral pattern (Figure 3E). However, unlike endogenous Fezf2, which is expressed in the VZ and in deep cortical layers (L5 and L6), the 2.7 kb-LacZ transgene was active in all cortical layers (compare Figure 3F with Figure 1C). LacZ was expressed in SOX2+ progenitor cells in the VZ and in the CTIP2+ or SATB2+ projection neurons (Figure 3G-I’). LacZ expression at P12 was similar to that observed at P0 (Additional file 1). Taken together, these results indicate that the 2.7 kb promoter is active throughout cortical development and is sufficient to drive transcription across all endogenous Fezf2 expression domains (progenitor cells, L5 and L6 neurons). However, its expression in upper cortical layers indicates that additional cis- elements are required to properly coordinate Fezf2 expression.

Enhancer 434 activity is strongest in cortical progenitor cells

Previous work has shown that enhancer 434 is highly conserved across vertebrate species and is necessary for Fezf2 expression in the cortex [36]. Deletion of this enhancer from either a bacterial artificial chromosome (BAC) containing a Fezf2-EGFP reporter or from its endogenous locus resulted in a loss of EGFP or Fezf2 expression in the cerebral cortex [36]. However, it remains unknown whether enhancer 434 alone is sufficient to promote Fezf2 expression in subcerebral projection neurons.

We generated stable transgenic lines expressing LacZ under the control of enhancer 434 and the hsp68 minimal promoter [37]. At E11.5, ß-gal was expressed in SOX2+ and PAX6+ cortical progenitor cells (Figure 4A-B), including the metaphase cells that were labeled by PHH3 antibody at the ventricular surface (Figure 4C). In addition, Tuj1+ neurons located in the preplate expressed ß-gal (Figure 4D). Whole mount staining of P0 brains revealed strong LacZ activity throughout multiple brain regions (Figure 4E). However, the majority of enhancer 434 activity was in the VZ of the cortex and basal ganglia (Figure 4F). Immunohistochemistry with antibodies for LacZ and the radial glial cell (RGC) marker BLBP demonstrated significant co-localization (Figure 4G). Additionally, some LacZ+ cells in the VZ expressed the RGC marker PAX6 (Figure 4H). Some cells in the cortical plate expressed LacZ, however a minority of these LacZ+ cells expressed the projection neuron markers SOX5 and SATB2 (Additional file 2). Thus, at P0 enhancer 434 activity is strongest in cortical progenitor cells. This strong LacZ signal observed in the VZ is consistent with the activity of enhancer 434 reported by the VISTA Enhancer Browser (http://enhancer.lbl.gov).

Figure 4
figure 4

Enhancer 434 is active in cortical progenitor cells. (A-C) Immunohistochemistry demonstrated LacZ expression in progenitor cells at E11.5 that co-expressed SOX2 (A), PAX6 (B) and PHH3 (C). LacZ was also expressed in a few postmitotic neurons in the preplate marked by Tuj1 (D). X-Gal staining of whole mount P0 brains (E) and sections (F) demonstrated reporter activity in the VZ. (G, H) Immunohistochemistry using ß-Gal antibody combined with antibodies for RGC markers BLBP (G) and PAX6 (H). (I, K, L) In adult animals, the majority of enhancer 434-LacZ+ cells were in GFAP+ astrocytes throughout the forebrain. A subset of non-astrocyte like cells expressed SATB2 (J, J’). Arrows represent co-expression of LacZ and the indicated markers. Hip, hippocampus; WM, white matter. Scale bars: (D) 50 μm, (E) 250 mm, (F) 500 μm, (G) 25 μm, (H) 10 μm, (I) 500 μm, (J) 100 μm, (J’) 50 μm, (K) 25 μm.

Full size image

In adult mice, LacZ expression was observed in the cerebral cortex, white matter, hippocampus, and striatum (Figure 4I-L). Most of the LacZ+ cells exhibited typical astrocyte-like morphology and expressed the astrocyte marker GFAP (Figure 4K, L). A minority of LacZ+ cells in the cerebral cortex expressed the cortical projection neuron marker SATB2 (Figure 4J’). This shift in enhancer 434 activity suggests that it may have divergent functions during development versus in adult animals. Taken together, these data demonstrate that during cortical development enhancer 434 activity is strongest in progenitor cells, one of the endogenous expression domains of Fezf2.

Enhancer 1316 is active in deep-layer projection neurons in the cerebral cortex

We next investigated the activity of enhancer 1316. MultiZ alignment of this region showed strong vertebrate conservation, especially within the middle 500 bp (Additional file 3). We generated stable transgenic lines expressing LacZ under control of enhancer 1316 and the hsp68 minimal promoter. At E11.5, ß-gal was present throughout the newly generated preplate (Figure 5A), in Tuj1+ neurons (Figure 5D). LacZ+ cells did not express the progenitor cell markers PAX6 or SOX2 (Figure 5B, C).

Figure 5
figure 5

Enhancer 1316 is active in deep-layer cortical neurons. (A-D) Immunohistochemical analysis of E11.5 brain sections using antibodies for ß-Gal (A), ß-Gal and PAX6 (B), ß-Gal and SOX2 (C), and ß-Gal and Tuj1 (D). (E, F) X-Gal staining of P0 whole mount brains (E) and brain sections (F). (G-I) Immunohistochemistry using ß-Gal antibody combined with antibodies for SOX2 (G), CTIP2 (H ), and SATB2 (I). Arrows represent co-expression of LacZ and the indicated markers. Arrowheads indicate a lack of co-expression. Scale bars: (A) 200 μm, (D) 50 μm, (E) 250 mm, (F) 500 μm, (I) 100 μm, (I’) 25 μm.

Full size image

Whole mount staining at P0 revealed LacZ activity in deep layers of the cerebral cortex (Figure 5E). LacZ was expressed in the subplate and in some deep-layer neurons, but not in cortical progenitors or astrocytes (Figure 5F). Some LacZ+ cells expressed CTIP2 and SATB2 (Figure 5H-I’). 'None of the LacZ+ cells expressed SOX2 (Figure 5G, G’). Analysis at P12 revealed a similar LacZ expression pattern to that observed at P0 (Additional file 4). Taken together, these results indicate that within the cerebral cortex, enhancer 1316 is strictly active in deep-layer neurons.

Discussion

We set out to understand how expression of Fezf2 is spatially and temporally controlled during development of the cerebral cortex. Previous work demonstrates that Fezf2 transcription levels are critically important for specification of cortical projection neuron fates [13–17, 22–24, 31]. Our ChIP-seq data indicate that multiple transcription factors that are expressed in deep-layer neurons bind to evolutionarily conserved sequences around the Fezf2 locus. The large number of transcription factors that bound enhancer 434 underscores its developmental importance. Recent deletion analysis demonstrated that this enhancer is critical for subcerebral projection neuron identity and connectivity [36]. In the current study, the majority of enhancer 434 activity during cortical neurogenesis was in progenitor cells, suggesting that this element also functions to promote Fezf2 expression in the VZ, one of the endogenous Fezf2 expression domains (Figure 6).

Figure 6
figure 6

A model for the regulation of Fezf2 transcription in the cortex. The 2.7 kb promoter was sufficient to drive transcription across all endogenous Fezf2 expression domains throughout development of the cerebral cortex. Enhancer 434 exhibited strongest activity in cortical progenitor cells and in contrast enhancer 1316 was strictly active in deep-layer postmitotic neurons.

Full size image

An alternative interpretation of this result is that different experimental strategies may account for the somewhat distinct conclusions regarding the activity of enhancer 434. In the study by Shim et al. [36], enhancer 434 was deleted from either a bacterial artificial chromosome containing a Fezf2-EGFP reporter or from its endogenous genomic locus. In both cases, deletion of enhancer 434 resulted in a loss of GFP or Fezf2 expression, respectively, and failed extension of subcerebral projections. In the present study, we assayed the activity of enhancer 434 in isolation and found that it drove LacZ activity strongest in progenitor cells with lower levels of reporter activity in postmitotic neurons. These data indicate that when taken out of its endogenous locus, enhancer 434 is sufficient to drive reporter expression in the progenitor cells. It is important to note however that both the Shim et al. study [36] and the data presented here indicate a critical role for enhancer 434 in the regulation of Fezf2 transcription.

Although the present study identifies conserved regulatory elements around the Fezf2 locus, functional enhancer-promoter interactions cannot be established based upon transgenic reporter assays alone. Specifically, whether enhancer 1316 functionally interacts with the Fezf2 promoter to regulate transcription remains unknown. Recently published high throughput chromosome conformation capture (Hi-C) suggests an interaction between enhancer 1316 and the Fezf2 promoter [38]. However, this enhancer does not appear to be essential for Fezf2 expression during development. Transgenic mice containing a modified BAC (RP23-141E17) that express EGFP or CRE from the Fezf2 open reading frame have been generated. Although enhancer 1316 is not contained within this BAC, GFP, or CRE expression in these transgenic mice recapitulates endogenous Fezf2 gene expression [36, 39, 40], suggesting that this enhancer is not essential for Fezf2 expression during development. Thus, it is possible that additional enhancer(s) present on the RP23-141E17 BAC may function redundantly with enhancer 1316 to promote Fezf2 expression in deep layer neurons.

Multiple cis-regulatory sequences around Fezf2 exhibited distinct yet overlapping activities during cortical development. These results are similar to the regulation of the eve gene locus in Drosophila where multiple, partially redundant enhancers control expression in individual stripes along the anterior-posterior axis of the embryo [41, 42]. Ultimately, combined activity of these enhancers is required to drive the precise spatio-temporal expression of eve. Similar regulatory paradigms have also been uncovered in mammals through analysis of the interferon-beta [43] or Fgf8[44] loci. In our study, neither of the identified enhancers nor the 2.7 kb promoter, when assayed in isolation, were sufficient to drive LacZ reporter expression in an identical pattern to that of endogenous Fezf2 expression. This suggests the presence of an additional enhancer (enhancers) that promotes high levels of expression specifically in L5 neurons. Moreover, the strong activity of the 2.7 kb promoter in upper cortical layers indicates that repressor sequences are necessary to restrict its activity to cortical progenitor cells and deep-layer neurons. Identification of these regulatory sequences combined with an increased understanding of the chromatin environment surrounding the Fezf2 locus should help to shed light on the mechanisms that precisely regulate its transcription.

We recently reported that in addition to deep-layer cortical neurons, Fezf2 is expressed in progenitor cells throughout cortical neurogenesis [39]. Phenotypic analysis of Fezf2−/− mice indicates that it is required for both the patterning and maintenance of forebrain progenitors [45], and the fate specification of deep-layer cortical projection neurons [13–16]. In Fezf2−/− mutant cortices, subcerebral projection neurons switch their identity to become callosal or corticothalamic projection neurons. However, it remains unclear whether Fezf2 functions within cortical progenitor cells, postmitotic neurons or a combination of both in order to properly specify the fate of deep-layer cortical projection neurons. Identifying distinct promoter and enhancer sequences that regulate Fezf2 transcription may help provide answers to this question.

Conclusions

Given recent progress identifying putative mammalian enhancers [37], it is critical that we understand the spatial and temporal activities of these sequences in the regulation of individual genes, in order to appreciate the deleterious effects of mutations in non-coding sequences identified through GWAS. Focusing on Fezf2, a key regulator of cortical development and deep-layer projection neuron fate, our study suggests that multiple enhancer and promoter activities can coordinate gene expression during brain development. Recent work indicates that Fezf2 is expressed in neocortical progenitors throughout development. Although mice lacking Fezf2 exhibit developmental defects largely within deep-layer neurons (L5 and L6), its role in cortical progenitors versus postmitotic neurons remains unclear. Identifying the regulatory mechanisms that control Fezf2 transcription will enable the functional dissection of its role within these distinct cellular populations. We propose that the combined activities of the 2.7 kb promoter, enhancer 434, and possibly enhancer 1316 constitute a cis-regulatory module that controls Fezf2 in distinct domains of the cerebral cortex, ultimately leading to its dynamic expression during cortical development (Figure 6).

Methods

Animals

All experiments in this study were carried out in accordance with protocols approved by the IACUC at the University of California, Santa Cruz and were performed in accordance with institutional and federal guidelines. The day of vaginal plug detection was designated as embryonic day 0.5 (E0.5). The day of birth was designated as postnatal day 0 (P0). Transgenic mice were generated using standard protocols [46]. To generate stable transgenic lines, founders were outcrossed to CD1 wild-type females for a minimum of three generations before analysis. Number of founder lines generated: 2.7 kb-LacZ (2), enhancer 434-LacZ (3), enhancer 1316-LacZ (4).

Plasmids

Generation of the 2.7 kb-lacZ plasmid was previously described [35]. For enhancer 434-lacZ, the genomic region was obtained from mouse genomic DNA by PCR using primers: ATCGCTCGAGCAGGCTGTAGGATGGGCAGCAGGAGTTTC and ATCGAAGCTTGTAACAAGTCAGGTGAGCAGGCGGTA. The product was then cloned into the hsp68-lacZ expression vector using Gateway cloning according to the manufacturer’s protocol [11]. Enhancer 1316-lacZ was generated from human genomic DNA using primers AAACCACACAGCTGGTTTCC and TTTCCCGATAGATCGTCAGC and cloned into the hsp68-lacZ expression vector [37].

Histology

Immunostaining and in situ hybridization were performed as previously described [47]. The Fezf2 cRNA probe corresponds to nucleotides 644 to 1,374 of mouse Fezf2 (GenBank: NC_000080). LacZ staining was preformed according to standard protocols. Primary antibodies used: Chicken anti β-gal (Abcam, 1:500), Rabbit anti BLBP (Millipore, 1:500), Rat anti CTIP2 (Abcam, 1:1,000), Guinea Pig anti GFAP (Advaned Immuno Chemical, 1:100), Rabbit anti PAX6 (Covance, 1:100), PHH3 (Cell Signaling, 1:100), Rabbit anti SATB2 (Abcam, 1:1,000), Goat anti SOX2 (Santa Cruz Biotech, 1:500), Rabbit anti SOX5 (Abcam, 1:500), Rabbit anti TBR1 (Abcam, 1:1,000), Mouse anti Tuj1 (Covance, 1:1,000). Primary antibodies were detected using AlexaFluor-conjugated secondary antibodies (Invitrogen, 1:1,000). DNA was visualized with DAPI (1:50,000).

Microscopy

Bright field and epiflourescence images were captured on an Olympus BX51 microscope using a Q Imaging Retiga EXj camera or a Keyence BZ-9000 microscope. Confocal images were captured on a Leica TCS SP5 confocal microscope. Images were processed using Adobe Photoshop CS5 to adjust brightness and contrast.

ChIP-Seq

Chromatin immunoprecipation was performed as previously described [24]. Antibodies used were Rabbit anti FOXG1 (Cell Signaling), Rabbit anti NFIB (Active Motif), Rabbit anti SOX5 (Abcam), and Rabbit anti TBR1 (Abcam). Sequencing libraries were generated using the Illumina TruSeq kit according to the manufacturer’s protocol. Sequencing was performed on an Illumina Hiseq 2000 at the UCSC Genome Technology Center. Input DNA was sequenced as control. Sequencing reads were mapped to the mouse genome (mm9) using the Bowtie mapping algorithm. Non-overlapping reads and PCR duplicates were removed. Peaks were called using the MACS algorithm [48].

Abbreviations

BAC:

Bacterial artificial chromosome

ß-gal:

ß-galactosidase

ChIP-seq:

Chromatin co-immunoprecipitation and high throughput DNA sequencing

E:

Embryonic day

GWAS:

Genome-wide association study

L5:

Layer 5

L6:

Layer 6

P:

Postnatal day

PCR:

Polymerase chain reaction

RGC:

Radial glial cell

SCPN:

Subcerebral projection neurons

VZ:

Ventricular zone.

References

  1. Waterston RH, Lindblad-Toh K, Birney E, Rogers J, Abril JF, Agarwal P, Agarwala R, Ainscough R, Alexandersson M, An P, Antonarakis SE, Attwood J, Baertsch R, Bailey J, Barlow K, Beck S, Berry E, Birren B, Bloom T, Bork P, Botcherby M, Bray N, Brent MR, Brown DG, Brown SD, Bult C, Burton J, Butler J, Campbell RD, Mouse Genome Sequencing Consortium, et al: Initial sequencing and comparative analysis of the mouse genome. Nature. 2002, 420: 520-562. 10.1038/nature01262.

    Article  CAS  PubMed  Google Scholar 

  2. Siepel A, Bejerano G, Pedersen JS, Hinrichs AS, Hou M, Rosenbloom K, Clawson H, Spieth J, Hillier LW, Richards S, Weinstock GM, Wilson RK, Gibbs RA, Kent WJ, Miller W, Haussler D: Evolutionarily conserved elements in vertebrate, insect, worm, and yeast genomes. Genome Res. 2005, 15: 1034-1050. 10.1101/gr.3715005.

    Article  PubMed Central  CAS  PubMed  Google Scholar 

  3. Venter JC, Adams MD, Myers EW, Li PW, Mural RJ, Sutton GG, Smith HO, Yandell M, Evans CA, Holt RA, Gocayne JD, Amanatides P, Ballew RM, Huson DH, Wortman JR, Zhang Q, Kodira CD, Zheng XH, Chen L, Skupski M, Subramaniam G, Thomas PD, Zhang J, Gabor Miklos GL, Nelson C, Broder S, Clark AG, Nadeau J, McKuisck VA, Zinder N, et al: The sequence of the human genome. Science. 2001, 291: 1304-1351. 10.1126/science.1058040.

    Article  CAS  PubMed  Google Scholar 

  4. Lander ES, Linton LM, Birren B, Nusbaum C, Zody MC, Baldwin J, Devon K, Dewar K, Doyle M, FitzHugh W, Funke R, Gage D, Harris K, Heaford A, Howland J, Kann L, Lehockzy J, LeVine R, McEwan P, McKernan K, Meldrim J, Mesirov JP, Miranda C, Morris W, Naylor J, Raymond C, Rosetti M, Santos R, Sheridan A, Sougnez C, et al: Initial sequencing and analysis of the human genome. Nature. 2001, 409: 860-921. 10.1038/35057062.

    Article  CAS  PubMed  Google Scholar 

  5. Williamson I, Hill RE, Bickmore WA: Enhancers: from developmental genetics to the genetics of common human disease. Dev Cell. 2011, 21: 17-19. 10.1016/j.devcel.2011.06.008.

    Article  CAS  PubMed  Google Scholar 

  6. Genomes Project C: A map of human genome variation from population-scale sequencing. Nature. 2010, 467: 1061-1073. 10.1038/nature09534.

    Article  Google Scholar 

  7. International Schizophrenia Consortium: Rare chromosomal deletions and duplications increase risk of schizophrenia. Nature. 2008, 455: 237-241. 10.1038/nature07239.

    Article  Google Scholar 

  8. Hamilton SP, Woo JM, Carlson EJ, Ghanem N, Ekker M, Rubenstein JL: Analysis of four DLX homeobox genes in autistic probands. BMC Genetics. 2005, 6: 52-10.1186/1471-2156-6-52.

    Article  PubMed Central  PubMed  Google Scholar 

  9. Sebat J, Lakshmi B, Malhotra D, Troge J, Lese-Martin C, Walsh T, Yamrom B, Yoon S, Krasnitz A, Kendall J, Leotta A, Pai D, Zhang R, Lee YH, Hicks J, Spence SJ, Lee AT, Puura K, Lehtimaki T, Ledbetter D, Gregersen PK, Bregman J, Sutcliffe JS, Jobanputra V, Chung W, Warburton D, King MC, Skuse D, Geschwind DH, Gilliam TC, et al: Strong association of de novo copy number mutations with autism. Science. 2007, 316: 445-449. 10.1126/science.1138659.

    Article  PubMed Central  CAS  PubMed  Google Scholar 

  10. Wray GA: The evolutionary significance of cis-regulatory mutations. Nat Rev Genet. 2007, 8: 206-216.

    Article  CAS  PubMed  Google Scholar 

  11. Visel A, Blow MJ, Li Z, Zhang T, Akiyama JA, Holt A, Plajzer-Frick I, Shoukry M, Wright C, Chen F, Afzal V, Ren B, Rubin EM, Pennacchio LA: ChIP-seq accurately predicts tissue-specific activity of enhancers. Nature. 2009, 457: 854-858. 10.1038/nature07730.

    Article  PubMed Central  CAS  PubMed  Google Scholar 

  12. Kwan KY, Sestan N, Anton ES: Transcriptional co-regulation of neuronal migration and laminar identity in the neocortex. Development. 2012, 139: 1535-1546. 10.1242/dev.069963.

    Article  PubMed Central  CAS  PubMed  Google Scholar 

  13. Chen B, Schaevitz LR, McConnell SK: Fezl regulates the differentiation and axon targeting of layer 5 subcortical projection neurons in cerebral cortex. Proc Natl Acad Sci U S A. 2005, 102: 17184-17189. 10.1073/pnas.0508732102.

    Article  PubMed Central  CAS  PubMed  Google Scholar 

  14. Chen B, Wang SS, Hattox AM, Rayburn H, Nelson SB, McConnell SK: The Fezf2-Ctip2 genetic pathway regulates the fate choice of subcortical projection neurons in the developing cerebral cortex. Proc Natl Acad Sci U S A. 2008, 105: 11382-11387. 10.1073/pnas.0804918105.

    Article  PubMed Central  CAS  PubMed  Google Scholar 

  15. Chen JG, Rasin MR, Kwan KY, Sestan N: Zfp312 is required for subcortical axonal projections and dendritic morphology of deep-layer pyramidal neurons of the cerebral cortex. Proc Natl Acad Sci U S A. 2005, 102: 17792-17797. 10.1073/pnas.0509032102.

    Article  PubMed Central  CAS  PubMed  Google Scholar 

  16. Molyneaux BJ, Arlotta P, Hirata T, Hibi M, Macklis JD: Fezl is required for the birth and specification of corticospinal motor neurons. Neuron. 2005, 47: 817-831. 10.1016/j.neuron.2005.08.030.

    Article  CAS  PubMed  Google Scholar 

  17. Rouaux C, Arlotta P: Fezf2 directs the differentiation of corticofugal neurons from striatal progenitors in vivo. Nat Neurosci. 2010, 13: 1345-1347. 10.1038/nn.2658.

    Article  PubMed Central  CAS  PubMed  Google Scholar 

  18. De la Rossa A, Bellone C, Golding B, Vitali I, Moss J, Toni N, Luscher C, Jabaudon D: In vivo reprogramming of circuit connectivity in postmitotic neocortical neurons. Nat Neurosci. 2013, 16: 193-200. 10.1038/nn.3299.

    Article  CAS  PubMed  Google Scholar 

  19. Rouaux C, Arlotta P: Direct lineage reprogramming of post-mitotic callosal neurons into corticofugal neurons in vivo. Nat Cell Biol. 2012, 15: 214-221.

    Article  Google Scholar 

  20. Hirata T, Suda Y, Nakao K, Narimatsu M, Hirano T, Hibi M: Zinc finger gene fez-like functions in the formation of subplate neurons and thalamocortical axons. Dev Dyn. 2004, 230: 546-556. 10.1002/dvdy.20068.

    Article  CAS  PubMed  Google Scholar 

  21. Inoue K, Terashima T, Nishikawa T, Takumi T: Fez1 is layer-specifically expressed in the adult mouse neocortex. Eur J Neurosci. 2004, 20: 2909-2916. 10.1111/j.1460-9568.2004.03763.x.

    Article  PubMed  Google Scholar 

  22. Han W, Kwan KY, Shim S, Lam MM, Shin Y, Xu X, Zhu Y, Li M, Sestan N: TBR1 directly represses Fezf2 to control the laminar origin and development of the corticospinal tract. Proc Natl Acad Sci U S A. 2011, 108: 3041-3046. 10.1073/pnas.1016723108.

    Article  PubMed Central  CAS  PubMed  Google Scholar 

  23. Kwan KY, Lam MM, Krsnik Z, Kawasawa YI, Lefebvre V, Sestan N: SOX5 postmitotically regulates migration, postmigratory differentiation, and projections of subplate and deep-layer neocortical neurons. Proc Natl Acad Sci U S A. 2008, 105: 16021-16026. 10.1073/pnas.0806791105.

    Article  PubMed Central  CAS  PubMed  Google Scholar 

  24. McKenna WL, Betancourt J, Larkin KA, Abrams B, Guo C, Rubenstein JL, Chen B: Tbr1 and Fezf2 regulate alternate corticofugal neuronal identities during neocortical development. J Neurosci. 2011, 31: 549-564. 10.1523/JNEUROSCI.4131-10.2011.

    Article  PubMed Central  CAS  PubMed  Google Scholar 

  25. Alcamo EA, Chirivella L, Dautzenberg M, Dobreva G, Farinas I, Grosschedl R, McConnell SK: Satb2 regulates callosal projection neuron identity in the developing cerebral cortex. Neuron. 2008, 57: 364-377. 10.1016/j.neuron.2007.12.012.

    Article  CAS  PubMed  Google Scholar 

  26. Azim E, Jabaudon D, Fame RM, Macklis JD: SOX6 controls dorsal progenitor identity and interneuron diversity during neocortical development. Nat Neurosci. 2009, 12: 1238-1247. 10.1038/nn.2387.

    Article  PubMed Central  CAS  PubMed  Google Scholar 

  27. Baranek C, Dittrich M, Parthasarathy S, Bonnon CG, Britanova O, Lanshakov D, Boukhtouche F, Sommer JE, Colmenares C, Tarabykin V, Atanasoski S: Protooncogene Ski cooperates with the chromatin-remodeling factor Satb2 in specifying callosal neurons. Proc Natl Acad Sci U S A. 2012, 109: 3546-3551. 10.1073/pnas.1108718109.

    Article  PubMed Central  CAS  PubMed  Google Scholar 

  28. Batista-Brito R, Rossignol E, Hjerling-Leffler J, Denaxa M, Wegner M, Lefebvre V, Pachnis V, Fishell G: The cell-intrinsic requirement of Sox6 for cortical interneuron development. Neuron. 2009, 63: 466-481. 10.1016/j.neuron.2009.08.005.

    Article  PubMed Central  CAS  PubMed  Google Scholar 

  29. Britanova O, de Juan RC, Cheung A, Kwan KY, Schwark M, Gyorgy A, Vogel T, Akopov S, Mitkovski M, Agoston D, Sestan N, Molnar Z, Tarabykin V: Satb2 is a postmitotic determinant for upper-layer neuron specification in the neocortex. Neuron. 2008, 57: 378-392. 10.1016/j.neuron.2007.12.028.

    Article  CAS  PubMed  Google Scholar 

  30. Hanashima C, Li SC, Shen L, Lai E, Fishell G: Foxg1 suppresses early cortical cell fate. Science. 2004, 303: 56-59. 10.1126/science.1090674.

    Article  CAS  PubMed  Google Scholar 

  31. Lai T, Jabaudon D, Molyneaux BJ, Azim E, Arlotta P, Menezes JR, Macklis JD: SOX5 controls the sequential generation of distinct corticofugal neuron subtypes. Neuron. 2008, 57: 232-247. 10.1016/j.neuron.2007.12.023.

    Article  CAS  PubMed  Google Scholar 

  32. Miyoshi G, Fishell G: Dynamic FoxG1 expression coordinates the integration of multipolar pyramidal neuron precursors into the cortical plate. Neuron. 2012, 74: 1045-1058. 10.1016/j.neuron.2012.04.025.

    Article  PubMed Central  CAS  PubMed  Google Scholar 

  33. Piper M, Moldrich RX, Lindwall C, Little E, Barry G, Mason S, Sunn N, Kurniawan ND, Gronostajski RM, Richards LJ: Multiple non-cell-autonomous defects underlie neocortical callosal dysgenesis in Nfib-deficient mice. Neural Dev. 2009, 4: 43-10.1186/1749-8104-4-43.

    Article  PubMed Central  PubMed  Google Scholar 

  34. Visel A, Minovitsky S, Dubchak I, Pennacchio LA: VISTA Enhancer Browser–a database of tissue-specific human enhancers. Nucleic Acids Res. 2007, 35: D88-D92. 10.1093/nar/gkl822.

    Article  PubMed Central  CAS  PubMed  Google Scholar 

  35. Hirata T, Nakazawa M, Muraoka O, Nakayama R, Suda Y, Hibi M: Zinc-finger genes Fez and Fez-like function in the establishment of diencephalon subdivisions. Development. 2006, 133: 3993-4004. 10.1242/dev.02585.

    Article  CAS  PubMed  Google Scholar 

  36. Shim S, Kwan KY, Li M, Lefebvre V, Sestan N: Cis-regulatory control of corticospinal system development and evolution. Nature. 2012, 486: 74-79.

    PubMed Central  CAS  PubMed  Google Scholar 

  37. Visel A, Taher L, Girgis H, May D, Golonzhka O, Hoch RV, McKinsey GL, Pattabiraman K, Silberberg SN, Blow MJ, Hansen DV, Nord AS, Akiyama JA, Holt A, Hosseini R, Phouanenavong S, Plajzer-Frick I, Shoukry M, Afzal M, Kaplan T, Kriegstein AR, Rubin EM, Ovcharenko I, Pennacchio LA, Rubinstein JL: A high-resolution enhancer atlas of the developing telencephalon. Cell. 2013, 152: 895-908. 10.1016/j.cell.2012.12.041.

    Article  PubMed Central  CAS  PubMed  Google Scholar 

  38. Dixon JR, Selvaraj S, Yue F, Kim A, Li Y, Shen Y, Hu M, Liu JS, Ren B: Topological domains in mammalian genomes identified by analysis of chromatin interactions. Nature. 2012, 485: 376-380. 10.1038/nature11082.

    Article  PubMed Central  CAS  PubMed  Google Scholar 

  39. Guo C, Eckler MJ, McKenna WL, McKinsey GL, Rubenstein JL, Chen B: Fezf2 expression identifies a multipotent progenitor for neocortical projection neurons, astrocytes, and oligodendrocytes. Neuron. 2013, 80: 1167-1174. 10.1016/j.neuron.2013.09.037.

    Article  CAS  PubMed  Google Scholar 

  40. Gong S, Zheng C, Doughty ML, Losos K, Didkovsky N, Schambra UB, Nowak NJ, Joyner A, Leblanc G, Hatten ME, Heintz N: A gene expression atlas of the central nervous system based on bacterial artificial chromosomes. Nature. 2003, 425: 917-925. 10.1038/nature02033.

    Article  CAS  PubMed  Google Scholar 

  41. Andrioli LP, Vasisht V, Theodosopoulou E, Oberstein A, Small S: Anterior repression of a Drosophila stripe enhancer requires three position-specific mechanisms. Development. 2002, 129: 4931-4940.

    CAS  PubMed  Google Scholar 

  42. Perry MW, Boettiger AN, Levine M: Multiple enhancers ensure precision of gap gene-expression patterns in the Drosophila embryo. Proc Natl Acad Sci U S A. 2011, 108: 13570-13575. 10.1073/pnas.1109873108.

    Article  PubMed Central  CAS  PubMed  Google Scholar 

  43. Thanos D, Maniatis T: Virus induction of human IFN beta gene expression requires the assembly of an enhanceosome. Cell. 1995, 83: 1091-1100. 10.1016/0092-8674(95)90136-1.

    Article  CAS  PubMed  Google Scholar 

  44. Marinic M, Aktas T, Ruf S, Spitz F: An integrated holo-enhancer unit defines tissue and gene specificity of the Fgf8 regulatory landscape. Dev Cell. 2013, 24: 530-542. 10.1016/j.devcel.2013.01.025.

    Article  CAS  PubMed  Google Scholar 

  45. Shimizu T, Nakazawa M, Kani S, Bae YK, Shimizu T, Kageyama R, Hibi M: Zinc finger genes Fezf1 and Fezf2 control neuronal differentiation by repressing Hes5 expression in the forebrain. Development. 2010, 137: 1875-1885. 10.1242/dev.047167.

    Article  CAS  PubMed  Google Scholar 

  46. Nagy A: Manipulating the mouse embryo: a laboratory manual. 2003, Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press, 3

    Google Scholar 

  47. Eckler MJ, McKenna WL, Taghvaei S, McConnell SK, Chen B: Fezf1 and Fezf2 are required for olfactory development and sensory neuron identity. J Comp Neurol. 2011, 519: 1829-1846. 10.1002/cne.22596.

    Article  PubMed Central  CAS  PubMed  Google Scholar 

  48. Zhang Y, Liu T, Meyer CA, Eeckhoute J, Johnson DS, Bernstein BE, Nusbaum C, Myers RM, Brown M, Li W, Liu XS: Model-based analysis of ChIP-Seq (MACS). Genome Biol. 2008, 9: R137-10.1186/gb-2008-9-9-r137.

    Article  PubMed Central  PubMed  Google Scholar 

Download references

Acknowledgments

We are grateful to Masahiko Hibi (Nagoya University) for providing the 2.7 kb-LacZ reporter construct and for valuable insight during the completion of these experiments. We thank Armen Shamaman and the UCSC Transgenic Facility for generating transgenic mice. We are grateful to the UCSC Genome Technology Center for performing DNA sequencing. Ben Abrams and the UCSC Microscopy center provided support with image acquisition. We thank Drs. Lindsay Hinck, David Feldheim, Jennifer Betancourt, and Muriel Kmet for critical review of the manuscript. Members of the Chen lab and Drs. Lindsay Hinck, David Feldheim, and Susan McConnell provided valuable discussion during the completion of these experiments. This work was funded by grants from California Institute of Regenerative Medicine (RN1-00530-01) to BC, the NIMH (R01-MH094589) to BC, the NHGRI (R01HG003988) to AV, the NINDS (R01NS062859A) to AV and the NINDS (NS34661) to JLRR.

Author information

Author notes

    Authors and Affiliations

    1. Department of Molecular, Cell and Developmental Biology, University of California, Santa Cruz, CA, USA

      Matthew J Eckler, Kathryn A Larkin, William L McKenna, Chao Guo, Robin Roque & Bin Chen

    2. Center for Biomolecular Science and Engineering, University of California, Santa Cruz, CA, USA

      Sol Katzman

    3. Genomics Division, MS 84–171, Lawrence Berkeley National Laboratory, Berkeley, CA, USA

      Axel Visel

    4. U.S. Department of Energy Joint Genome Institute, Walnut Creek, CA, USA

      Axel Visel

    5. Nina Ireland Laboratory of Developmental Neurobiology, Department of Psychiatry, University of California, San Francisco, CA, USA

      John L L Rubenstein

    Authors
    1. Matthew J Eckler
      View author publications

      You can also search for this author in PubMed Google Scholar

    2. Kathryn A Larkin
      View author publications

      You can also search for this author in PubMed Google Scholar

    3. William L McKenna
      View author publications

      You can also search for this author in PubMed Google Scholar

    4. Sol Katzman
      View author publications

      You can also search for this author in PubMed Google Scholar

    5. Chao Guo
      View author publications

      You can also search for this author in PubMed Google Scholar

    6. Robin Roque
      View author publications

      You can also search for this author in PubMed Google Scholar

    7. Axel Visel
      View author publications

      You can also search for this author in PubMed Google Scholar

    8. John L L Rubenstein
      View author publications

      You can also search for this author in PubMed Google Scholar

    9. Bin Chen
      View author publications

      You can also search for this author in PubMed Google Scholar

    Corresponding author

    Correspondence to Bin Chen.

    Additional information

    Competing interests

    The authors declare that they have no competing interests.

    Authors’ contributions

    MJE: conception and design, data collection and analysis, manuscript writing, and final approval of the manuscript. KAL: data collection and analysis, final approval of the manuscript. WLM: data collection and analysis, manuscript writing, and final approval of the manuscript. CG: conception and design, data collection, manuscript writing, and final approval of the manuscript. RR: data collection and final approval of the manuscript. SK: analyzing sequencing data and final approval of the manuscript. AV: generating the enhancer 1316-LacZ reporter construct, manuscript editing, and final approval of the manuscript. JLRR: generating the enhancer 1316-LacZ reporter construct, manuscript editing, and final approval of the manuscript. BC: conception and design, data analysis, manuscript writing, and final approval of the manuscript. All authors read and approved the final manuscript.

    Kathryn A Larkin, William L McKenna contributed equally to this work.

    Electronic supplementary material

    13064_2013_273_MOESM1_ESM.pdf

    Additional file 1: 2.7 kb promoter activity at P12. (A) The activity of the 2.7 kb promoter at P12 was similar to that observed at P0, with expression throughout the cortex and the strongest activity in upper layers. (B-C’) LacZ was expressed in some CTIP2+ and TBR1+ cells in deep layers. (D, D’) However, the highest density of LacZ+ cells was in upper layers cells that expressed SATB2. Panels B’-D’ show amplified areas boxed in panels B-D, respectively. Arrows represent co-expression of LacZ and the indicated markers. Arrowheads indicate a lack of co-expression. Ctx, cortex; LV, lateral ventricle; Str, striatum. Scale bars: (a) 500 μm, (d) 100 μm, (d’) 50 μm. (PDF 1 MB)

    13064_2013_273_MOESM2_ESM.pdf

    Additional file 2: Enhancer 434 activity at P0. (A-B’) LacZ expression was observed in a few post-mitotic neurons expressing SOX5 (A, A’) or SATB2 (B, B’). A’ and B’ show amplified areas boxed in panels A and B. Arrows represent co-expression of LacZ and the indicated markers. Arrowheads indicate a lack of co-expression. Scale bars: (B) 100 μm, (B’) 50 μm. (PDF 2 MB)

    13064_2013_273_MOESM3_ESM.pdf

    Additional file 3: Vertebrate conservation of enhancer 1316. The UCSC genome browser was used to perform Multiz alignment of enhancer 1316 from 30 vertebrates. Strong conservation was most evident within the middle 500 bp (approximately) of this region. Basewise conservation is represented as greyscale darkness with higher conservation corresponding to darker values. Gap Annotation: single line, no bases in the aligned species; double line, aligning species has one or more un-alignable bases in the gap region; red coloring, aligning species has Ns in the gap region. Genomic Breaks: green square brackets, enclose shorter alignments consisting of DNA from one genomic context in the aligned species nested inside a larger chain of alignments from a different genomic context. (PDF 107 KB)

    13064_2013_273_MOESM4_ESM.pdf

    Additional file 4: Activity of enhancer 1316 at P12. (A-D’) Expression at P12 mirrored P0. (A) X-Gal staining. (B-D’) Immunohistochemistry analysis of the brain sections. Some LacZ positive cells in deep layers expressed CTIP2 (B-B’), SATB2 (C-C’), and TBR1 (D-D’). B’-D’ show enlargement of areas boxed in panels B-D. Ctx, cortex; LV, lateral ventricle; Str, striatum. Scale bars: (A) 500 μm, (D) 100 μm, (D’) 20 μm. (PDF 3 MB)

    Authors’ original submitted files for images

    Rights and permissions

    Open Access This article is published under license to BioMed Central Ltd. This is an Open Access article is distributed under the terms of the Creative Commons Attribution License ( https://creativecommons.org/licenses/by/2.0 ), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly credited. The Creative Commons Public Domain Dedication waiver ( https://creativecommons.org/publicdomain/zero/1.0/ ) applies to the data made available in this article, unless otherwise stated.

    Reprints and permissions

    About this article

    Cite this article

    Eckler, M.J., Larkin, K.A., McKenna, W.L. et al. Multiple conserved regulatory domains promote Fezf2 expression in the developing cerebral cortex. Neural Dev 9, 6 (2014). https://doi.org/10.1186/1749-8104-9-6

    Download citation

    • Received:

    • Accepted:

    • Published:

    • DOI: https://doi.org/10.1186/1749-8104-9-6

    Keywords

    Neural Development

    ISSN: 1749-8104