Mating between heterozygotes did not result in any Insm1 ^-/- pups, which indicates that this genotype causes embryonic lethality. This lethality does not seem to result in or from developmental delay, as KO, wild type and heterozygous embryos of the same age did not differ in weight (Additional file 1) or in anatomically defined developmental hallmarks (Additional file 2). In order to determine the embryonic stage of lethality, we generated timed pregnancies and collected embryos at set days post-coitus (from here onwards denoted as E for embryonic day, with the first day after a night of mating considered E0.5). At E11.5, Insm1 ^-/- embryos appeared at the expected Mendelian ratio (1/4). At E12.5 to E15.5, Insm1 ^-/- embryos appeared at somewhat lower ratios than expected and by E16.5 there was a severe drop in viability (Additional file 3). Hence, Insm1 ^-/- embryos suffer lethality around E16. In an attempt to obtain older embryos, we administered L-DOPA (1 mg/ml) to pregnant dams starting no later than 7.5 days post-coitus (dpc), as it has been reported that this treatment increases viability of a similar KO 23 26 . Although in our hands this treatment did not improve the viability at earlier (E11.5 to E14.5) stages, we were able to obtain a few embryos as old as E20.5 (Additional file 3). We used these embryos to examine the effects of Insm1 deletion on neural development but we did not explore the reasons for this lethality, which others attribute to a catecholamine deficiency resulting from developmental defects of the sympathoadrenal lineage 23 .

After close examination of paired sections of KO and wild-type littermate embryos, we focused our attention on the OE, which appeared altered in the KO. The embryonic OE at E14.5 and later stages contains two cellular layers that are easily distinguished based on nuclear morphology: apical and neuro-basal (Figure 2D, H). The apical layer consists of densely packed, elongated nuclei that correspond to proliferative progenitors. These apical progenitors undergo mitosis at the luminal side of the epithelium and initially generate additional progenitors, some of which migrate basally to divide terminally and produce neurons 1 25 27 . Eventually, progenitors that remain in the apical layer generate the apically located sustentacular (glial-like) support cells 28 . The neuro-basal layer consists of rounder, more densely spaced nuclei that correspond to basal progenitors and to their progeny, the intermediately located neurons. With a nuclear DAPI stain we detected no change in the thickness of the entire OE at E12.5, E14.5 and E18.5 (Additional file 4). However, the apical layer of proliferative progenitors was thicker in Insm1 ^-/- than in Insm1 ^+/+ embryos at E14.5 (+47%) and E18.5 (+59%), and the neuro-basal layer was conversely thinner (Additional file 4). Nuclear counts confirm that, compared to Insm1 ^+/+ littermate OEs, Insm1 ^-/- OEs contained more apical cells (+57% at E14.5 and +44% at E18.5, measured per unit area of the whole OE) and fewer neuro-basal ones (-37% at E14.5 and -24% at E18.5, measured per unit area of the whole OE) (Figure 2).

The reduction in neuro-basal cells observed in the OE of Insm1 ^-/- embryos could reflect a reduction in basal progenitors, in neurons, or in both. We labeled nascent neurons with antibodies against the βIII-tubulin isoform (TuJ1). At most stages examined, the Insm1 ^-/- OEs had significantly fewer nascent (TuJ1+) neurons than the OEs of their Insm1 ^+/+ and Insm1 ^+/- littermates (-43% at E11.5, -47% at E12.5, -39% at E14.5, and -37% at E18.5; Figure 3). At E10.5, the small reduction measured is not statistically significant. Hence, we conclude that as early as E11.5 there are fewer neurons in the OEs of Insm1 ^-/- embryos than of Insm1 ^+/+ and Insm1 ^+/- littermates. We also labeled with antibodies to the olfactory marker protein (OMP), a marker of mature olfactory receptor neurons, which are detected as early as about E14 29 30 31 . We also found a reduction (-92 to -94%) of OMP+ cells at E14.5 and E18.5 (at earlier stages there is little or no OMP expression) (Figure 3). Hence, deletion of Insm1 results in fewer nascent and mature neurons in the embryonic OE.

A decrease in neurons could be caused by an increase in cell death. In the embryonic OE of the mouse, there are two waves of apoptosis. The first peaks at E11.5 and is thought to correspond to morphogenetic changes. The second ranges from E13.5 to E17.5 (peaking at E15.5) and corresponds to innervations of olfactory receptor neurons with their targets in the olfactory bulb. Both nascent and mature olfactory receptor neurons undergo apoptosis during development 32 . We labeled apoptotic cells with antibodies against activated cleaved caspase 3 (ACC3) and confirmed the low levels of apoptosis at E12.5 and the higher levels at E11.5 and E14.5 (Figure 4). Compared to Insm1 ^+/+ littermates, Insm1 ^-/- embryos displayed increased apoptosis in their OEs at E14.5 (P < 0.05) and perhaps also at E18.5 (P = 0.11), but not at E12.5 (P = 0.62) or E11.5 (P = 0.6). Therefore, the reduction of neurons (detected at E11.5) precedes by at least 2 days any increase in apoptosis. Furthermore, the number of additional apoptotic cells at E14.5 in the Insm1 ^-/- OE is approximately 100 times lower than the number of missing neurons (compare Figures 4G and 3E). Hence, although apoptosis might contribute slightly to the reduction of neurons, it is not the primary cause of this reduction.

A reduction in neurons might also result from a change in progenitor proliferation. A decrease in progenitors or an increase in their cell cycle length would result in a decrease in nascent neurons. Paradoxically, an increase in progenitors might also result in a temporary reduction of neurons produced if, as in the egl-46 mutant nematodes, progenitors continue dividing instead of producing two neurons 2 3 4 . We labeled OE progenitors at E12.5 with Ki67 antibodies (which marks cells at all phases of the cell cycle) 33 34 35 and by 30 minutes of 5-bromo-2-deoxyuridine (BrdU) incorporation (which labels all cells in S-phase) and found no difference in the overall number of progenitors between Insm1 ^-/- and Insm1 ^+/+ littermates (Figure 5).

Because the length of the S-phase is largely invariant and changes in cell cycle length reflect changes in G1, we could estimate changes in overall cell cycle length by calculating the fraction of all dividing cells (Ki67+) that are in S-phase (BrdU+) 36 . A lengthening of the cell cycle, which would result in a delay in the production of neurons, would be reflected in a lower BrdU+/Ki67+ ratio. However, we detected no difference in this ratio when comparing OEs of Insm1 ^-/- and of Insm1 ^+/+ littermate embryos (Figure 5). Hence, we conclude that the deletion of Insm1 does not cause an overall lengthening of the cell cycle among OE progenitors.

The above measurements did not distinguish between apical and basal progenitors, and would not have detected a cell cycle lengthening in basal progenitors (which could explain the reduction in neurons) if this was compensated by a cell cycle shortening in apical progenitors. However, we also detected no difference in BrdU+/Ki67+ ratios when considering only basal progenitors (Figure 5). We therefore conclude that the reduction of olfactory receptor neurons in Insm1 ^-/- embryos is not caused by a lengthening of the cell cycle in basal OE progenitors.

We also found no difference between Insm1 ^-/- and Insm1 ^+/+ embryos in the overall number of progenitors in mitosis, which we labeled with antibodies against phosphohistone H3 (pH3) 37 at E10.5, E12.5 and E14.5 (Figure 6). This label, however, permits us to distinguish between progenitors undergoing mitosis apically, which generate more progenitors, and progenitors undergoing mitosis basally, which after one or more divisions produce neurons 38 . In egl-46 mutant nematodes, there is a transient increase in proliferative (P/P) divisions at the expense of neuronogenic (N/N) divisions 2 3 4 . In the mouse embryonic OE, this might translate into increased apical and decreased basal progenitors. Indeed, we found an increase of apical mitoses (+42% at E12.5) and a decrease of basal mitoses (-45% at E12.5 and -35% at E14.5) in the OEs of Insm1 ^-/- compared to Insm1 ^+/+ littermates (Figure 6D-I). The decrease in basal mitoses could mathematically account for the decrease in neurons (Figure 3) observed in the embryonic OEs of Insm1 ^-/- mice. Additionally, the increase in apical divisions may explain the increase in thickness (Additional file 4) and cells (Figure 2) of the apical layer of the Insm1 ^-/- mice.

The thickening of the apical layer and thinning of the neuro-basal layer roughly compensate for each other because, as indicated above, the overall thickness of the OE does not change in Insm1 ^-/- embryos. We also measured the entire surface areas of the OE sections used for estimating number of neurons (Figure 3) and confirmed no difference in the OE size of Insm1 ^-/- compared to that of Insm1 ^+/+ littermates (Additional file 5).

In the OE the immediate neuronal precursors (INPs), progenitors that divide terminally to produce two neurons (N/N divisions), are located basally and express the basic-helix-loop-helix transcription factor NEUROD1 38 39 40 41 42 43 44 . These terminal progenitors are generated from the transit amplifying progenitors (TAPs), which in the medial and dorso-lateral OE express another basic-helix-loop-helix protein, ASCL1 (also known as MASH1) (reviewed in 1 25 41 43 44 45 (Figure 7J). In the embryonic OE, ASCL1-expressing TAPs appear to translocate from the apical compartment to the basal lamina and are present throughout the thickness of the OE. By immunohistochemistry (IHC) on sections of E12.5 embryos, we confirmed that antibodies raised against ASCL1 label cells located across the OE that undergo mitosis at apical and intermediate positions (Figure 7A, D-F, J). In addition, antibodies to NEUROD1 label basal cells, most of which (79%) express Ki67 and are therefore dividing (Figure 7G-J). With double IHC we confirm that ASCL1 and NEUROD1 antibodies label different populations of progenitors at this stage (Figure 7A-C). Using these antibodies, we find that in the OEs of Insm1 ^-/- embryos at E12.5 (compared to Insm1 ^+/+ and Insm1 ^+/- littermates) there are fewer (-45%) NEUROD1-expressing cells (presumably the terminally dividing neuronogenic progenitors, or INPs) and more (+24%) ASCL1-expressing cells (presumably the TAPs transitioning from apical to basal) (Figure 7K-O).

Although the reduction of NEUROD1-expressing cells is consistent with a decrease in terminally dividing (N/N) neuronogenic progenitors, this reduction could also occur if Insm1 is an activator of NeuroD1. In fact, Insm1 protein can bind to the NeuroD1 promoter, although the presumed effect is to repress it 46 . In addition, although the reduction in basal mitoses is consistent with a decrease in neuronogenic progenitors, a reduction in basal progenitors could also occur if apical progenitors fail to translocate basally but still divide terminally to produce two neurons. Hence, we sought to independently test for terminal divisions by sequential labeling of OE progenitors. We injected pregnant mothers at E12.5 with the nucleoside analog 5-ethynyl-2'-deoxyuridine (EdU) for incorporation in the DNA of cells undergoing S-phase over the following several hours. We then injected another nucleoside analog, BrdU, 12 hours later (approximately the length of one cell cycle). At E14.5, we labeled sections with OE to determine which cells that had incorporated EdU (detected by chemical fluorescence; see Materials and methods) and/or BrdU (detected by immunofluorescence) (Figure 8A). We considered that cells dividing at E12.5 that continued to divide would be double labeled (EdU+ and BrdU+), whereas progenitors terminally dividing at E12.5 would appear EdU+ but BrdU-. We found that the OEs of Insm1 ^-/- embryos, compared with those of Insm1 ^+/+ and Insm1 ^+/- littermates, contained 35% fewer EdU+ and BrdU- cells (Figure 8). Hence, we conclude that the absence of Insm1 causes a decrease in terminally dividing progenitors.

Previous studies in the embryonic OE have shown that Insm1 is expressed in basal progenitors during mitosis and in intermediate cells, some of which are undergoing mitosis but many others are no longer dividing (Ki67-negative; shown at E14.5 in Figure 9 of 15 ). Furthermore, Insm1 was not expressed in most apical progenitors or in many TuJ1-expressing neurons 15 16 . By combined in situ hybridization and IHC we confirmed that, in the embryonic OE, Insm1 mRNA is expressed in intermediate and basal cells, including all progenitors undergoing mitosis basally (all 29 basal mitoses from 6 sections of OE at E12.5 and all 19 basal mitoses from 2 sections at E14.5 expressed Insm1; Figure 9 and similar data not shown), and most of the progenitors undergoing mitosis at intermediate positions (defined as more than 2 nuclei from the base or the apex; 11 intermediate mitoses out of 14 at E12.5 and all 7 intermediate mitoses at E14.5 expressed Insm1; Figure 9 and similar data not shown). By contrast, at the same stages Insm1 mRNA is rarely present in apical mitoses, although it is in some apical cells (at E12.5, only 1 of 12 apical cells expressing Insm1 was in mitosis, whereas 48 of 49 apical mitoses did not express Insm1; at E14.5, only 1 of 13 apical cells expressing Insm1 was in mitosis, whereas 21 of 22 apical mitoses did not express Insm1; Figure 9 and similar data not shown). Together, the data suggest that Insm1 is activated in apical cells transitioning towards the base, stays on during basal divisions and is turned off in postmitotic cells as they begin to differentiate into neurons (Figure 10C). This pattern of expression is reminiscent of that of egl-46 in nematode neuronal lineages (Figure 10A). One potential difference is that in nematodes egl-46 is expressed exclusively in terminally dividing (N/N) progenitors, whereas Insm1 seems to be expressed in these as well as in the earlier, presumably proliferative progenitors transitioning from apex to base. This presumed onset of expression in transitioning progenitors is consistent with the defect in apical to basal progenitor transitions we have observed in Insm1 ^-/- OEs.

This study does not address the molecular mechanism by which Insm1 regulates the progression from early to late neuronal progenitors. In this regard, studies on EGL-46 offer no clues as its mechanism of action also has not been explored. Some insight, however, might be drawn from previous work revealing that Insm1 has at least two molecular mechanisms of action: it can bind promoter elements to repress transcription of certain genes and it can also promote cell cycle arrest and exit 5 . The basic helix-loop-helix transcription factor ASCL1 binds to an element in the promoter of Insm1, and Ascl1 is required for Insm1 transcriptional activation in the sympathoadrenal lineage 47 , ganglionic eminences 48 and OE 16 . Furthermore, in the sympathoadrenal lineage, ganglionic eminences and cortex, ablation of Insm1 led to an up-regulation of Ascl1, and these results were interpreted as evidence that Insm1 represses Ascl1 16 23 . Similarly, the increase in ASCL1-expressing cells in the OE of Insm1 ^-/- embryos here reported could result from direct transcriptional repression. However, this increase in ASCL1-expressing progenitors does not explain the decrease in basal progenitors and neurons, both of which require ASCL1.

Insm1 also binds an element in the NeuroD1 promoter and represses its transcription in pancreatic islet cell development 5 46 . However, this regulatory interaction fails to explain the decrease of NEUROD1-expressing cells in the absence of Insm1. Alternatively, the retention of OE progenitors in a proliferative state in the absence of Insm1 might be more in keeping with the proposed role of this zinc-finger protein in cell cycle exit 5 49 .

Our results do explain the anatomical changes observed in Insm1^-/- OEs. The increase in apical progenitors observed at E12.5 may account for the increase in cells observed in the apical layer at subsequent stages (E14.5 and E18.5). Many of these are likely sustentacular cells or their precursors because by E14.5 there is no longer an increase in apical progenitors. Likewise, the decrease of progenitors that are basal, NEUROD1-positive and terminally dividing at E12.5 may explain the decrease in nascent and mature neurons observed at this and later stages. Although apoptosis may also contribute to the decrease in neurons, its later onset (E14.5) and infrequent occurrence (100 times fewer cells appear undergoing programmed cell death than neurons are missing) indicates that it cannot be the sole or principal cause for neuronal decrease. The net increase in apical progenitors and cells and net decrease in basal progenitors and neurons seem to compensate for each other during the stages examined here because we never detected an overall difference in the size (measured in thickness, cell density or surface area in Figure 2 and Additional files 4 and 5) between Insm1 ^-/- and Insm1 ^+/+ OEs.

The slight increase in cell death detected in Insm1 ^-/- OEs might also be suggestive of a role of Insm1 in cell survival. This role would be modest, since it affects a very small fraction of Insm1 ^-/- OE cells during the period examined (from E10.5 to E18.5). However, the increase in cell death is observed at a stage (E14.5) when olfactory receptor neurons innervate their targets in the olfactory bulb. In the wild type, the peak of cell death at this moment is thought to reflect the elimination of neurons that failed to establish proper synaptic contacts 32 . Hence, given that the Insm1 ^-/- embryos may also experience a reduction in olfactory bulb neurons (as they do in cortical neurons 16 ), the slight increase in OE cell death may be an indirect consequence and not reflect a cell autonomous role of Insm1 in promoting neuronal survival.

The decrease in OMP-expressing, mature olfactory receptor neurons is more pronounced than the decrease in TuJ1-expressing, immature neurons (approximately 40% versus approximately 92%, respectively; Figure 3). The increase in cell death mentioned above could contribute to this difference if the cells dying are neurons prior to maturation. We were not able to elucidate which cells undergo programmed cell death in the OE, but previous studies have shown these to be TuJ1-expressing, young neurons 32 . Although the increase of dying (that is, ACC3-expressing) cells (0.3 cells per 0.1 mm² at E14.5) is ten-fold lower than the decrease in OMP-expressing neurons (3.1 cells per 0.1 mm² at E14.5; after correcting for the 39% decrease in immature, TuJ1-expressing neurons), the transient nature of apoptotic cells underestimates their frequency. For example, if an apoptotic cell expresses ACC3 during a 3-hour period (a guess, since this has not been measured), then the density of missing cells (dying at a density of 0.3 cells per 0.1 mm² mentioned above) would reach 3 per 0.1 mm² in 30 hours, a value consistent with the observed reduction in OMP-expressing neurons.

The disproportionately larger reduction in OMP-expressing mature neurons than in TuJ1-expressing young neurons might also suggest a role for Insm1 in neuronal differentiation. In fact, Insm1 has been implicated in the differentiation of pancreatic and intestinal endocrine cells 19 , adrenal chromaffin cells 23 and hindbrain monoaminergic neurons 24 . However, the disproportionate reduction in OMP-expressing cells may simply reflect a more steep change in the onset of OMP expression than in the onset of TuJ1 expression during the observed stages (E14.5 and E18.5). Due to the lethality of Insm1 ^-/- embryos, we cannot determine whether all TuJ1-expressing nascent neurons will mature to express OMP, or whether many of them will fail to differentiate (thus revealing a role for Insm1 in olfactory neuron differentiation).

Mammalian Insm1 and nematode egl-46 have a similar pattern of expression in neuronal lineages: both are transiently expressed in neuronogenic progenitors and nascent neurons and not in many of the earlier, proliferative progenitors (Figure 10A, C). In particular, nematode egl-46 is expressed in progenitors of the motorneuron and Q-neuroblast lineages undergoing N/N but not P/P or P/N divisions, whereas mouse Insm1 is expressed in OE progenitors undergoing mitosis basally (many of which are neuronogenic) but not apically (many of which are proliferative). Although our data cannot determine whether Insm1 is exclusively expressed in terminally dividing N/N progenitors of OE, they indicate that Insm1 is expressed in late neuronogenic progenitors and not in many of the earlier, proliferative progenitors. In nematodes, mutation of egl-46 results in a transient decrease in neuronogenic (N/N) divisions and a concomitant increase in proliferative (P/N or P/P) divisions (Figure 10B). This occurs because progenitors that by lineage are expected to terminally divide fail to do so, and instead some of their progeny divide one or more times. Similarly we find that, in the mammalian OE, deletion of Insm1 results in fewer terminally dividing neuronogenic progenitors and in a concomitant increase in proliferative (apical and ASCL1-expressing) progenitors (Figure 10D). Hence, we propose that Insm1 and egl-46 play evolutionarily conserved roles in promoting terminal, neuronogenic divisions.

It should be noted that, in both organisms, the mutant effects are modest. In egl-46 mutants, only some terminal progenitors are delayed, and only by one or two cell divisions 2 3 4 . In Insm1 mutants, the increase in apical progenitors is transient (detected at E12.5 but not at E10.5 or E14.5) and small (42% increase; Figure 6), as is the decrease in basal progenitors (45% at E12.5 and 35% at E14.5; Figure 6). The subtlety of both phenotypes demonstrates that these two genes are not essential for the transition from proliferative to neuronogenic progenitors, and instead suggests that their function is to fine tune their occurrence.

A difference between the egl-46(loss-of-function) and Insm1 ^-/- phenotypes is that, in mutant nematodes, an increase in proliferative divisions eventually results in additional neurons, whereas mouse Insm1 ^-/- OEs still contain fewer neurons than the wild type at the latest stages examined (E18.5). The embryonic lethality of Insm1 ^-/- prevents determining whether more neurons would be eventually produced. However, in these mutant OEs we also detected an increase in apical cells, which would eventually become sustentacular glia. Because apical progenitors stop transitioning basally by E16.5 1 25 , the increase in apical progenitors observed at E12.5 may eventually result in more sustentacular cells and not in more neurons.

In embryonic cortex, progenitors undergoing mitosis at the apical side of the ventricular zone generate more progenitors, some of which migrate in the basal direction. These basally located progenitors divide one or more times to produce neurons, which migrate to the cortical plate and differentiate 50 51 52 53 54 55 . The effects of Insm1 deletion in OE reported here share similarities with those reported in dorsal telencephalon 16 . In both embryonic OE and cortex, Insm1 deletion results in an enlargement of the area with apical progenitors (the ventricular zone in cortex and the apical layer in OE), a decrease in basal, neuronogenic progenitors (the intermediate progenitor cells of the cortical subventricular zone and the INPs of OE), and a decrease in neurons. Furthermore, both neuroepithelia share striking similarities that extend beyond the Insm1 ^-/- phenotype. At embryonic stages, both have progenitors dividing apically (near the airways in OE and near the ventricle in cortex), some of which display radial glia characteristics 56 . These apical progenitors undergo interkinetic nuclear migration and generate glial-like epithelial cells (ependymal in cortex and sustentacular in OE) as well as additional progenitors that migrate basally (to the basal lamina in OE and to the subventricular zone in cortex). In both embryonic neuroepithelia, many of these basal progenitors divide terminally to produce neurons. After embryogenesis, proliferation subsides in apical areas but is maintained in basal areas (subventricular zone and base of OE), where adult neural stem cells reside and neurogenesis occurs. All these similarities suggest that both neuroepithelia share a common mechanism of progenitor migration, proliferation and differentiation orchestrating neurogenesis and gliogenesis. We propose that common molecular pathways involving Insm1 and other factors may direct the development of OE and cortex and, perhaps, other neural tube and placodal neuroepithelia.

Construction of Insm1 targeting vector. A mouse 129/SvEv genomic BAC library, RPCI-22, was screened using a mouse Insm1 3' UTR probe isolated from pCRII7 15 by digesting with EcoRI. Three BAC clones were isolated and mapped using restriction enzymes. Two subclones from BAC clone 439G2 were used to generate the Insm1 targeting vector (Figure 1A). A 15.2 kb BglII genomic fragment containing the Insm1 coding sequence, 6.9 kb of 5' sequence and 6.7 kb of 3' sequence was cloned into the BglII site of pCMV-Myc (Clontech, Mountain View, California, USA) to generate pCMV-Myc G2Bgl. A 6-kb EcoRI fragment from the G2 BAC was cloned into the EcoRI site of pBluescript-SK- (Stratagene, Lost Pines, Texas, USA) to generate pSK-G2Eco24. A 1.05-kb XbaI-EcoRI genomic fragment from pSK-G2Eco24, the 3' homology arm, was cloned into pSK-, which had been cut with SmaI and EcoRI, to generate pSK-3'arm. The thymidine kinase cassette of pSK-PGKTK (a gift of Dr L Jameson) was subcloned as an EcoRI-XhoI fragment into pSK-3'arm to generate pSK-3'armTK. The floxed neomycin (Neo) cassette was released from pSK-FloxPGKNeo (a gift of Dr L Jameson) by cutting with XbaI; after blunting, the floxed Neo cassette was subcloned in an inverted orientation into pSK3'armTK that had been cut with BamHI and blunted to create pSKneo3'armTK. A 4-kb 5' fragment, the 5' homology arm, was cut from pCMV-Myc G2Bgl and subcloned into pSKneo3'armTK, which had been cut with XbaI and blunted, to generate the targeting vector, pSK insm1KO#2.

Generation of mouse ES cells and chimeric mice containing a targeted deletion of Insm1 The targeting vector pSKinsm1KO#2 was linearized with NotI prior to electroporation. Electroporation, ES cell culture and blastocyst injections were performed by the Northwestern University Transgenic and Targeted Mutagenesis Laboratory. Homologous recombination in positive ES cell clones was confirmed by PCR with external primer insm1 A7(CGAACATCCATACATTGCCCTGTAGCTCAG) and primer neoA1(CTGCTAAAGCGCATGCTCCAGACTGCCTTG), which yield a 1.3-kb band from the recombined allele, and by Southern hybridization of BglII digested genomic DNA with a 168-bp 5' probe, which detects a 15-kb wild-type band and a 6.35-kb recombined band, and a 3' probe that detects a 15-kb wild-type band and a 7.5-kb recombined band.

Heterozygous mice were cross-bred in timed pregnancies in order to produce embryos of specific, known ages. Males and females were placed together for a single night and the following morning were checked for plugs and separated whether a plug was observed or not. Midnight of the night of mating was considered the beginning of E0. In order to rescue prenatal lethality of homozygous KO embryos collected at E12.5 and later, pregnant dams were supplied daily with L-DOPA (1 mg/mL, 0.25% ascorbic acid) starting no later than 7 dpc (TCD0600, VWR Scientific, West Chester, PA, USA; D9628, Sigma-Aldrich) 23 26 . To obtain embryos at E11.5 and earlier, females in which plugs had been observed were collected for harvest. In order to collect embryos of developmental stages E12.5 and later, females were weighed at least once prior to 10.5 dpc, then every day at 10.5 dpc and later in order to track weight gain. Females in which consistent weight gain of at least 5 to 10% per day was observed were considered pregnant and were collected for harvest.

Dams were sacrificed by isoflurane overdose, followed by cervical dislocation. Embryos were harvested, and their tails were removed, washed in PBS, and processed for genotyping by PCR. KO embryos and either wild type (WT) or heterozygous (HET) littermates were assayed for developmental stage 57 , decapitated, and placed immediately into 4% paraformaldehyde fixative (1008A, Tousimis, Rockville, MD, USA). Following dehydration in sucrose gradient, embryos were weighed, and the heads were embedded in OCT compound (25608-930, VWR Scientific) and cryosectioned.

In situ hybridization and IHC were performed on 10-μm or 12-μm sections as previously described 15 . For IHC, the following primary antibodies were used: mouse anti-neuronal class III β-tubulin (1:500; clone Tuj1, Covance, Princeton, NJ, USA), goat anti-OMP (1:1,000; Wako Chemicals, Richmond, VA, USA), rabbit anti-pH3 (1:100; Millipore, Billerica, MA, USA), rabbit anti-ACC3 (1:1,000; Cell Signaling, Beverly, MA, USA), rat anti-BrdU (1:400; AbD Serotec, Raleigh, NC, USA), mouse anti-BrdU clone MoBu (1:50; Santa Cruz Biotechnology, Inc., Santa Cruz, CA, USA), mouse anti-Ki67 (1:200; BD Pharmingen, San Diego, CA, USA), mouse anti-Mash1 (1:100; BD Pharmingen), goat anti-NEUROD1 (1:50; Santa Cruz Biotechnology, Inc.).

Anti-Tuj1, anti-Ki67, and anti-ASCL1 staining required antigen retrieval with 10 mM sodium citrate in 0.25% Triton X-100 at 96°C, pH6.0 for 20 minutes, with a 30-minute cool-down, prior to blocking. Anti-BrdU staining required antigen exposure in 5 M HCl in 1% Triton X-100 for 15 minutes, prior to blocking. DAPI counterstain was applied to all IHC experiments, with the exception of those requiring the detection of BrdU because the acid antigen exposure ablates DAPI staining. Staining for ACC3 was performed using a horseradish peroxidase conjugated secondary antibody and a colorimetric 3,3'-diaminobenzadine (DAB) reaction kit (SK-4100, Vector Labs, Burlingame, CA, USA) to visualize positively stained cells. Detection followed the supplied protocol.

For BrdU/Ki67 double labeling, and for analysis of S-phase alone (BrdU only) 10 mM BrdU (B23151, Invitrogen, Carlsbad, CA, USA) was injected into pregnant dams (50 mg/kg) 30 minutes prior to sacrifice. For EdU/BrdU timed pulse labeling, 10 mM EdU (A10044, Invitrogen) was injected at 12.5 dpc (25 mg/kg), followed 12 hours later (13 dpc) by 10 mM BrdU (30 mg/kg). Embryos were allowed to develop until E14.5, at which point they were harvested and cryosectioned as described above. The mouse primary antibody to BrdU (clone MoBu) was used for IHC detection of BrdU because of demonstrated lack of cross-reactivity with EdU. Following IHC detection of BrdU, EdU was detected according to a modified protocol supplied by Invitrogen. Briefly, following BrdU IHC, slides were washed in 1× PBS, incubated in the EdU reaction cocktail (for 1.5 ml of reaction cocktail: 7.5 μl component B (AlexaFluor 488 azide), 30 μl component H (copper sulfate), 1,313 μl component G (reaction buffer), 150 μl component I (buffer additive), washed in 1% bovine serum albumin in 1× PBS, then cover-slipped.

Littermates were paired, and stained sections were visualized and photographed on a Nikon Eclipse E600 microscope with an RT Slider SPOT camera (version 2.3.1; Diagnostic Instruments, Sterling Heights, MI, USA). Coronal sections were aligned anatomically to assure that similar regions of OE were being compared between KO embryos and their littermates. Images were counted blindly using Image J software (available at 58 ) with the Cell Counter plugin (available at 59 ). BrdU/EdU co-labeling and BrdU/Ki67 co-labeling were evaluated using the Colocalization plugin (available at 60 ). Images were optimized for brightness and contrast using Image J and CorelDraw software. Data were cataloged and analyzed using Microsoft Excel 2007. For measurements of the thickness of the OE, anatomically aligned section pairs were measured multiple times (seven for E12.5, eight for E14.5, and nine for E18.5) along the straight portion of the septal OE. These measurements were summed to generate an average OE thickness. These paired averages were then compared to generate a percent difference in thickness between the KO and wild-type littermates. All other measurements were obtained from all areas of OE. A one-sample Student's t-test was used to evaluate the percent difference between the measurements of experimental (KO) and control (wild-type or HET) groups for both cell counts and for thickness measurements. Due to comparatively infrequent expression of ACC3, sections were not anatomically aligned, and all of the sections from one or more whole slides were quantified for positive staining of ACC3. Because the sections were not aligned anatomically for ACC3 expression, an unpaired Student's t-test was used for statistical analysis. To compare the mean weights of KO embryos to wild-type+HET embryos, an unpaired t-test was used. For all graphs, error bars reflect standard error of the mean (SEM) and *P ≤ 0.05, **P ≤ 0.01, ***P ≤ 0.001.